ID: 1137248732_1137248743

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1137248732 1137248743
Species Human (GRCh38) Human (GRCh38)
Location 16:46727768-46727790 16:46727813-46727835
Sequence CCACCCACCTCGGCCTCCCGAAG CACCCCGCCGGGCCTGCCATTGG
Strand - +
Off-target summary {0: 431, 1: 29459, 2: 115327, 3: 165579, 4: 187530} {0: 1, 1: 0, 2: 3, 3: 27, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!