ID: 1137248738_1137248743

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1137248738 1137248743
Species Human (GRCh38) Human (GRCh38)
Location 16:46727784-46727806 16:46727813-46727835
Sequence CCCGAAGTGCTGAGATTATAGGC CACCCCGCCGGGCCTGCCATTGG
Strand - +
Off-target summary {0: 43, 1: 2360, 2: 41536, 3: 274711, 4: 288888} {0: 1, 1: 0, 2: 3, 3: 27, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!