ID: 1137274903_1137274910

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1137274903 1137274910
Species Human (GRCh38) Human (GRCh38)
Location 16:46926994-46927016 16:46927039-46927061
Sequence CCCGGCAGTGGCTTTGGGCAGAG TATGACTTCCTCTCCGCACTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 301} {0: 1, 1: 0, 2: 1, 3: 4, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!