ID: 1137299454_1137299458

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1137299454 1137299458
Species Human (GRCh38) Human (GRCh38)
Location 16:47133687-47133709 16:47133720-47133742
Sequence CCTACAGCAGGTTTTAGGGAACT CAGTGTGGTTGGCAAGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 129} {0: 1, 1: 0, 2: 2, 3: 29, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!