ID: 1137343627_1137343631

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1137343627 1137343631
Species Human (GRCh38) Human (GRCh38)
Location 16:47634841-47634863 16:47634875-47634897
Sequence CCTGATAAGCAGTTTTGTTATCA GTTACTGGAGAGTTTTAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 223} {0: 1, 1: 0, 2: 2, 3: 107, 4: 2189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!