ID: 1137543046_1137543062

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1137543046 1137543062
Species Human (GRCh38) Human (GRCh38)
Location 16:49377860-49377882 16:49377884-49377906
Sequence CCCCTCTTCCCCCACTCACCCCC CTGGGTCTCCAAATGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 17, 3: 183, 4: 1801} {0: 1, 1: 1, 2: 4, 3: 47, 4: 407}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!