ID: 1137567102_1137567109

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1137567102 1137567109
Species Human (GRCh38) Human (GRCh38)
Location 16:49540088-49540110 16:49540136-49540158
Sequence CCTTCCTACTGGACATGACCAAG CTAGAATGCTGGCCTCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121} {0: 1, 1: 0, 2: 7, 3: 45, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!