ID: 1137586232_1137586238

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1137586232 1137586238
Species Human (GRCh38) Human (GRCh38)
Location 16:49665370-49665392 16:49665402-49665424
Sequence CCTAGGTGGAGGGACAACATTTG GTTTGCTAGGAGAAGTGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 261} {0: 1, 1: 0, 2: 1, 3: 14, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!