ID: 1137590452_1137590455

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1137590452 1137590455
Species Human (GRCh38) Human (GRCh38)
Location 16:49690161-49690183 16:49690178-49690200
Sequence CCATGCAAGAGAGGCTTCAGTGG CAGTGGCCCCATTTCACAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 187} {0: 1, 1: 2, 2: 12, 3: 114, 4: 548}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!