ID: 1137591419_1137591429

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1137591419 1137591429
Species Human (GRCh38) Human (GRCh38)
Location 16:49696450-49696472 16:49696503-49696525
Sequence CCATGGTGCCAGATTCCAAAAAC TTTTCTACCTCCAGTGGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 157} {0: 1, 1: 1, 2: 0, 3: 28, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!