ID: 1137601966_1137601973

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1137601966 1137601973
Species Human (GRCh38) Human (GRCh38)
Location 16:49762377-49762399 16:49762410-49762432
Sequence CCATGATGCCCAGACAGAATGCC GCCTGTGGCCAGCCCTTCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 171} {0: 1, 1: 0, 2: 1, 3: 17, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!