ID: 1137661651_1137661654

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1137661651 1137661654
Species Human (GRCh38) Human (GRCh38)
Location 16:50212316-50212338 16:50212344-50212366
Sequence CCAAAGTGCTAGGATTACAGGTG CACCACACTTGGCCTGTTACTGG
Strand - +
Off-target summary {0: 6033, 1: 84644, 2: 218857, 3: 252033, 4: 196794} {0: 1, 1: 0, 2: 5, 3: 69, 4: 491}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!