ID: 1137673789_1137673801

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1137673789 1137673801
Species Human (GRCh38) Human (GRCh38)
Location 16:50293833-50293855 16:50293861-50293883
Sequence CCCCCAGAATGAGGTAAAGCCCC CTTGGTGCCCAAGAGTGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 107} {0: 1, 1: 0, 2: 1, 3: 26, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!