ID: 1137702679_1137702684

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1137702679 1137702684
Species Human (GRCh38) Human (GRCh38)
Location 16:50508158-50508180 16:50508179-50508201
Sequence CCTCACCTGTGAGCTCCCATGAA AAGTCTCACCCAGGATCACACGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!