ID: 1137740749_1137740755

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1137740749 1137740755
Species Human (GRCh38) Human (GRCh38)
Location 16:50770603-50770625 16:50770635-50770657
Sequence CCCGAGCCCAGCTAATTTTTGTG GAGAGAGGGTTTCACCATGTTGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 121, 3: 907, 4: 1937} {0: 279, 1: 35589, 2: 128923, 3: 148593, 4: 97461}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!