ID: 1137924453_1137924460

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1137924453 1137924460
Species Human (GRCh38) Human (GRCh38)
Location 16:52526667-52526689 16:52526687-52526709
Sequence CCCCTCTCCTTTGGGAATTCCAG CAGGCGTAGTAGAGAGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 279} {0: 1, 1: 0, 2: 0, 3: 13, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!