ID: 1138176966_1138176973

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1138176966 1138176973
Species Human (GRCh38) Human (GRCh38)
Location 16:54909367-54909389 16:54909390-54909412
Sequence CCCCAGCCCTTTGTTCAAGTATC GCTGATGGTGGAACAGACCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!