ID: 1138237794_1138237797

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1138237794 1138237797
Species Human (GRCh38) Human (GRCh38)
Location 16:55399857-55399879 16:55399887-55399909
Sequence CCAGGCATCACATGCTTATGCAA GCTTTTTCTACTCACCATGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 125} {0: 1, 1: 0, 2: 0, 3: 17, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!