ID: 1138285530_1138285532

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1138285530 1138285532
Species Human (GRCh38) Human (GRCh38)
Location 16:55806692-55806714 16:55806706-55806728
Sequence CCTGGGTCAATTCATTTAAAACA TTTAAAACAGCTGCCGGTGCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 23, 4: 357} {0: 2, 1: 0, 2: 0, 3: 9, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!