ID: 1138287637_1138287646

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1138287637 1138287646
Species Human (GRCh38) Human (GRCh38)
Location 16:55822436-55822458 16:55822467-55822489
Sequence CCACAAGGCCTTCTCCTGAGCCC ATGTGGCAGCAGAAGCTGAGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 5, 3: 47, 4: 351} {0: 1, 1: 0, 2: 4, 3: 36, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!