ID: 1138292898_1138292900

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1138292898 1138292900
Species Human (GRCh38) Human (GRCh38)
Location 16:55863115-55863137 16:55863136-55863158
Sequence CCATAACGCACATACACACACAC ACTTGTGCACACCAGTGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 223, 3: 2678, 4: 8621} {0: 1, 1: 1, 2: 0, 3: 6, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!