ID: 1138349069_1138349081

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1138349069 1138349081
Species Human (GRCh38) Human (GRCh38)
Location 16:56336878-56336900 16:56336924-56336946
Sequence CCCGGGCAGGGGGCAGCGCTGAG CCCTCTGAGCACTGGGCCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 587} {0: 1, 1: 0, 2: 5, 3: 35, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!