ID: 1138366112_1138366113

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1138366112 1138366113
Species Human (GRCh38) Human (GRCh38)
Location 16:56479067-56479089 16:56479089-56479111
Sequence CCTCTTTCAGATAAAAGCTATGA ATGTTCACCTGTAAAATATATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 220} {0: 1, 1: 0, 2: 1, 3: 28, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!