ID: 1138376851_1138376857

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1138376851 1138376857
Species Human (GRCh38) Human (GRCh38)
Location 16:56570084-56570106 16:56570127-56570149
Sequence CCATCAGATACAGGAGTGGGTGA TCACAGAGCAGCCCCAGGTTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!