ID: 1138385600_1138385613

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1138385600 1138385613
Species Human (GRCh38) Human (GRCh38)
Location 16:56633747-56633769 16:56633797-56633819
Sequence CCAGGCTGCTGCTCCTGCTGCCC CTGTGTCTGCAAAGGGACGTTGG
Strand - +
Off-target summary {0: 8, 1: 9, 2: 14, 3: 190, 4: 1259} {0: 1, 1: 0, 2: 3, 3: 15, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!