ID: 1138387259_1138387266

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1138387259 1138387266
Species Human (GRCh38) Human (GRCh38)
Location 16:56644162-56644184 16:56644184-56644206
Sequence CCTCCTGCAAGAAGAGTGAGTGT TGGGGCCTTCCCTGGGAATCTGG
Strand - +
Off-target summary {0: 3, 1: 10, 2: 1, 3: 15, 4: 150} {0: 2, 1: 0, 2: 0, 3: 33, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!