ID: 1138405319_1138405330

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1138405319 1138405330
Species Human (GRCh38) Human (GRCh38)
Location 16:56788250-56788272 16:56788301-56788323
Sequence CCACCACAGCCTGGCACATCCTG CGGGCTCTGGCCTGATTTTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 38, 4: 415} {0: 1, 1: 0, 2: 2, 3: 12, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!