ID: 1138420025_1138420039

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1138420025 1138420039
Species Human (GRCh38) Human (GRCh38)
Location 16:56892939-56892961 16:56892984-56893006
Sequence CCCACCTCCTGCAGTGGACCCCA GGCCACCACCATCTTCCAGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 294} {0: 1, 1: 0, 2: 1, 3: 20, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!