ID: 1138454926_1138454936

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1138454926 1138454936
Species Human (GRCh38) Human (GRCh38)
Location 16:57115712-57115734 16:57115765-57115787
Sequence CCACAAATGATGCAGTGGGGGCT CAGCAGCCCCCTCCCTGCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 124} {0: 1, 1: 0, 2: 12, 3: 69, 4: 499}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!