ID: 1138459301_1138459308

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1138459301 1138459308
Species Human (GRCh38) Human (GRCh38)
Location 16:57138579-57138601 16:57138599-57138621
Sequence CCCCCGCAGGTCCTTCCTGGACT ACTCTGCAAGGCCCTCCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 202} {0: 1, 1: 0, 2: 0, 3: 16, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!