ID: 1138473873_1138473879

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1138473873 1138473879
Species Human (GRCh38) Human (GRCh38)
Location 16:57259219-57259241 16:57259259-57259281
Sequence CCATGACCCATCTCTTTGTACCA TACTCCTCCAAGTGTGGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 181} {0: 1, 1: 1, 2: 7, 3: 50, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!