ID: 1138497244_1138497249

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1138497244 1138497249
Species Human (GRCh38) Human (GRCh38)
Location 16:57416085-57416107 16:57416106-57416128
Sequence CCCACAGCGCAAGATGCGCTTCC CCACTCCGGCCTGTCACTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 50, 4: 124} {0: 1, 1: 0, 2: 2, 3: 10, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!