ID: 1138506303_1138506317

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1138506303 1138506317
Species Human (GRCh38) Human (GRCh38)
Location 16:57479946-57479968 16:57479990-57480012
Sequence CCCTTCCTGGGAGGACTGGCTCT GACCCAGGAAGGGAAGTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 23, 4: 228} {0: 1, 1: 1, 2: 1, 3: 53, 4: 457}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!