ID: 1138551658_1138551669

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1138551658 1138551669
Species Human (GRCh38) Human (GRCh38)
Location 16:57752017-57752039 16:57752045-57752067
Sequence CCCCAACGAGTACCTCCTGGCCT AGCTCTGACAGGTGAGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 9, 4: 119} {0: 1, 1: 1, 2: 5, 3: 43, 4: 391}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!