ID: 1138563547_1138563553

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1138563547 1138563553
Species Human (GRCh38) Human (GRCh38)
Location 16:57816340-57816362 16:57816355-57816377
Sequence CCTGGGGCCTGCCCCTCCTGGCT TCCTGGCTTCCTCTTGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 62, 4: 658} {0: 1, 1: 0, 2: 1, 3: 44, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!