ID: 1138577322_1138577330

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1138577322 1138577330
Species Human (GRCh38) Human (GRCh38)
Location 16:57916307-57916329 16:57916337-57916359
Sequence CCTTGGTGAAAGCCTTGAGTTTT GAGAGGCCCAGCCCCCAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 219} {0: 1, 1: 0, 2: 4, 3: 54, 4: 405}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!