ID: 1138631647_1138631652

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1138631647 1138631652
Species Human (GRCh38) Human (GRCh38)
Location 16:58299911-58299933 16:58299943-58299965
Sequence CCAGACAGAAGTTGCTTCTGCCT ACCAGAGGGCGCCACTAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 206} {0: 1, 1: 1, 2: 0, 3: 6, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!