ID: 1138930513_1138930517

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1138930513 1138930517
Species Human (GRCh38) Human (GRCh38)
Location 16:61649743-61649765 16:61649763-61649785
Sequence CCTACTTGCCTTCAGTCCTTATG ATGTGGCTATAAAGAGTAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 170} {0: 1, 1: 0, 2: 2, 3: 19, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!