|
Left Crispr |
Right Crispr |
Crispr ID |
1138938123 |
1138938129 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
16:61755908-61755930
|
16:61755961-61755983
|
Sequence |
CCTCGCTGGTTCAAGCGATTCTT |
CAAGCACATACAACCACGCCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 158, 2: 6233, 3: 64980, 4: 167117} |
{0: 2, 1: 3, 2: 239, 3: 3480, 4: 22885} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|