ID: 1138938128_1138938129

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1138938128 1138938129
Species Human (GRCh38) Human (GRCh38)
Location 16:61755943-61755965 16:61755961-61755983
Sequence CCAGAGTAGCTGGGATTACAAGC CAAGCACATACAACCACGCCTGG
Strand - +
Off-target summary {0: 2475, 1: 80392, 2: 213548, 3: 231438, 4: 181390} {0: 2, 1: 3, 2: 239, 3: 3480, 4: 22885}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!