ID: 1138953077_1138953078

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1138953077 1138953078
Species Human (GRCh38) Human (GRCh38)
Location 16:61937655-61937677 16:61937677-61937699
Sequence CCAACTTTTAGTTACAATAGAGC CTAGTATCACATATCTATAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 117} {0: 1, 1: 0, 2: 0, 3: 2, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!