ID: 1139382488_1139382496

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1139382488 1139382496
Species Human (GRCh38) Human (GRCh38)
Location 16:66542256-66542278 16:66542297-66542319
Sequence CCCCACAGACTATTAGATTTTAG CTTAACGAGAGCTTAATCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 160} {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!