ID: 1139418203_1139418206

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1139418203 1139418206
Species Human (GRCh38) Human (GRCh38)
Location 16:66831212-66831234 16:66831256-66831278
Sequence CCACTTAACTGGCTGTGAGATCT CAGTGTGCTCACCTGTGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 235} {0: 1, 1: 1, 2: 6, 3: 82, 4: 705}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!