ID: 1139461717_1139461723

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1139461717 1139461723
Species Human (GRCh38) Human (GRCh38)
Location 16:67127899-67127921 16:67127952-67127974
Sequence CCAGAAACACTGGGGGAAGGTAA TAACCTAAATGGGCAACAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 186} {0: 1, 1: 0, 2: 2, 3: 44, 4: 343}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!