ID: 1139465326_1139465337

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1139465326 1139465337
Species Human (GRCh38) Human (GRCh38)
Location 16:67151020-67151042 16:67151057-67151079
Sequence CCAGACTTCTGGAGCTCAGCTCC AGCACTCCGGCCTCAGAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 29, 4: 258} {0: 1, 1: 0, 2: 3, 3: 12, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!