ID: 1139472767_1139472774

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1139472767 1139472774
Species Human (GRCh38) Human (GRCh38)
Location 16:67187110-67187132 16:67187130-67187152
Sequence CCAACTCCAGGCTCCCCATCATT ATTTCCTGCCTGGAGATAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 274} {0: 1, 1: 0, 2: 1, 3: 17, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!