ID: 1139474296_1139474303

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1139474296 1139474303
Species Human (GRCh38) Human (GRCh38)
Location 16:67194888-67194910 16:67194928-67194950
Sequence CCTCACGTCCAAATAGTCCTCAG CCCTGGCAGTGCAGAAGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93} {0: 1, 1: 0, 2: 1, 3: 20, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!