ID: 1139480268_1139480275

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1139480268 1139480275
Species Human (GRCh38) Human (GRCh38)
Location 16:67226806-67226828 16:67226828-67226850
Sequence CCAAAGGAGGAACCGTTACCCAG GAGCTAGAAGGTCCCGGGATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39} {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!