ID: 1139544755_1139544770

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1139544755 1139544770
Species Human (GRCh38) Human (GRCh38)
Location 16:67645028-67645050 16:67645058-67645080
Sequence CCCTCCCACAACCCCGCTCCCGG CTCGAGCCGCGAGGCCGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 386} {0: 1, 1: 0, 2: 0, 3: 11, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!