ID: 1139587420_1139587428

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1139587420 1139587428
Species Human (GRCh38) Human (GRCh38)
Location 16:67913042-67913064 16:67913071-67913093
Sequence CCAGGTGTGGGCACATGCCTGTA GCTACTCAGGAGGCTGAGGTGGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 27, 3: 182, 4: 682} {0: 12857, 1: 106119, 2: 203574, 3: 219964, 4: 132850}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!