|
Left Crispr |
Right Crispr |
Crispr ID |
1139587420 |
1139587428 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
16:67913042-67913064
|
16:67913071-67913093
|
Sequence |
CCAGGTGTGGGCACATGCCTGTA |
GCTACTCAGGAGGCTGAGGTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 4, 2: 27, 3: 182, 4: 682} |
{0: 12857, 1: 106119, 2: 203574, 3: 219964, 4: 132850} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|